Phis1522
WebbTable S1. Oligonucleotides used in this study. Related to STAR Methods section. Name Sequence (5'-3') Purpose BoNTA_10R GGCCGGCATGCGGCCGGTACCCTCACTGCAGCGGACGTTCGCC WebbJuly 2, 2015: An aliquot of purified pHis1522-aTcdB vector was acquired from Dr. Xingmin Sun from the Tufts Vet School. NIH-recommended simple letter format MTA forms were signed by both parties. (aTcdB = atoxic Clostridium difficile toxin B) July 6, 2015: The pHis1522-aTcdB was diluted 1:10 and 1ul was transformed into JM109 E. coli.
Phis1522
Did you know?
WebbB Megaterium Expression Vector Phis1522, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, … WebbPlasmid Phis1522, supplied by Mobitec, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol …
WebbMobitec Inc phis1522 Phis1522, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, … Webb6 nov. 2008 · Background Major Clostridium difficile virulence factors are the exotoxins TcdA and TcdB. Due to the large size and poor stability of the proteins, the active recombinant TcdA and TcdB have been difficult to produce. Results The toxin genes tcdA and tcdB were amplified by PCR using chromosomal DNA from a toxigenic strain as a …
http://www.biofeng.com/zaiti/qita/pHIS1525.html WebbThe GFP-pHis1522 was induced with 0,5% of xylose. 5 mL of culture were centrifuged and the image was carried out from the cell pellet using ImageQuant 400 (GE Healthcare).
Webb11 apr. 2024 · pair 5556, bases 5261556 were AGI-6780 chemical information amplified and ligated into pHis1522-TcdB1-5260 through SpeI and BamHI restriction sites. The resulting construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced.
WebbTherefore, pHIS1522 can be used as a versatile expression vector in both, B. megaterium and E. coli. Keywords: Bacillus megaterium / Escherichia coli / Expression vector / Xylose operon Received: December 25, 2010; revised: March 31, 2011; accepted: April 8, 2011 DOI: 10.1002/elsc.201000225 1 Introduction commonly used to control the production of … dfw airport nursing roomWebbEventually, mutations were introduced in pHIS1522/TcdB by site-directed mutagenesis (QuikChange, Stratagene, La Jolla, CA, USA). Cloning of TcdB constructs with internal deletions was performed in the pHIS1522 vector backbone by first introducing a silent SpeI restriction site at bp position 2542 of the TcdB sequence with the QuikChange method. chuy\u0027s holiday hoursWebbSize-reduced pHIS1522 variant with sequence for C-terminal 6xHis-tag fusion (includingstop codon right downstream of the tag). dfw airport notaryWebb9 mars 2024 · Plasmid pHis1522 encoding his-tagged TcdB was a kind gift from Hanping Feng (University of Maryland, Baltimore, MD) and plasmid pHis1522 encoding his-tagged TcdA was a kind gift from Merck. Expression and isolation of recombinant TcdB and TcdA was as described by Yang et al. . Briefly, transformed Bacillus megateriumg chuy\u0027s holdings investor relationsWebbTaKaRa brevibacillus Brevibacillus, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more chuy\u0027s houston locationsWebbJuly 13, 2015: Primers were ordered for the pHis1522-aTcdB and pHsp70-Cas9 vectors. The primers were designed to install 21 extra bp at the ends, to be used as homologous … chuy\u0027s home officeWebbtor (pHIS1522, MoBiTec GmbH. Germany) using appropriate restriction endonuclease sites. Fragments of TcdB (TcdB Frags, Table 1) were generated via PCR; catalytic null proteins, TcdB D286A,D288A(TcdB Null) and TcdBD1849–2366 (NT-1848 Null), were created by site-directed mutagenesis (Quikchange II-XL, Agilent Technologies). DNA … chuy\u0027s houston menu